finding the longest string with maximum repetitions from a file











up vote
-3
down vote

favorite












This is my question. And I am stuck. It'd be great if I could get some help.




Write a program to find the biggest string that appears maximum times in the DNA.txt (uploaded on moodle).



For example:
Consider the following sequence DNA_X :



DNA_X: acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt




In the above sequence, the string “acccgttac” is the string with the highest length (9) that appears maximum number of times. The highlighted string below has the maximum length with the highest number of occurrence.




acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt







c++ data-structures linked-list tree







share|improve this question




















  • 1




    The problem is actually about finding the longest substring that repeats the most, the current topic is confusing.
    – JiaHao Xu
    Nov 11 at 2:25












  • Please clarify where you are stuck - that is: What have you tried already and where does your current solution fail? See stackoverflow.com/help/on-topic #3.
    – hlg
    Nov 11 at 2:31






  • 1




    "It'd be great if I could get some help." -- unfortunately, stackoverflow.com is not a tutorial web site. This is a Q&A site, with concrete, specific questions on programming-related topics.
    – Sam Varshavchik
    Nov 11 at 2:32










  • @Bishnu bro There is an inconsistency in this question: If you want the highest repetition times, a single-character string probably repeats most.
    – JiaHao Xu
    Nov 11 at 2:33






  • 1




    Why isn't c the answer ?
    – Hiroki
    Nov 11 at 5:10















up vote
-3
down vote

favorite












This is my question. And I am stuck. It'd be great if I could get some help.




Write a program to find the biggest string that appears maximum times in the DNA.txt (uploaded on moodle).



For example:
Consider the following sequence DNA_X :



DNA_X: acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt




In the above sequence, the string “acccgttac” is the string with the highest length (9) that appears maximum number of times. The highlighted string below has the maximum length with the highest number of occurrence.




acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt







c++ data-structures linked-list tree







share|improve this question




















  • 1




    The problem is actually about finding the longest substring that repeats the most, the current topic is confusing.
    – JiaHao Xu
    Nov 11 at 2:25












  • Please clarify where you are stuck - that is: What have you tried already and where does your current solution fail? See stackoverflow.com/help/on-topic #3.
    – hlg
    Nov 11 at 2:31






  • 1




    "It'd be great if I could get some help." -- unfortunately, stackoverflow.com is not a tutorial web site. This is a Q&A site, with concrete, specific questions on programming-related topics.
    – Sam Varshavchik
    Nov 11 at 2:32










  • @Bishnu bro There is an inconsistency in this question: If you want the highest repetition times, a single-character string probably repeats most.
    – JiaHao Xu
    Nov 11 at 2:33






  • 1




    Why isn't c the answer ?
    – Hiroki
    Nov 11 at 5:10













up vote
-3
down vote

favorite









up vote
-3
down vote

favorite











This is my question. And I am stuck. It'd be great if I could get some help.




Write a program to find the biggest string that appears maximum times in the DNA.txt (uploaded on moodle).



For example:
Consider the following sequence DNA_X :



DNA_X: acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt




In the above sequence, the string “acccgttac” is the string with the highest length (9) that appears maximum number of times. The highlighted string below has the maximum length with the highest number of occurrence.




acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt







c++ data-structures linked-list tree







share|improve this question















This is my question. And I am stuck. It'd be great if I could get some help.




Write a program to find the biggest string that appears maximum times in the DNA.txt (uploaded on moodle).



For example:
Consider the following sequence DNA_X :



DNA_X: acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt




In the above sequence, the string “acccgttac” is the string with the highest length (9) that appears maximum number of times. The highlighted string below has the maximum length with the highest number of occurrence.




acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt







c++ data-structures linked-list tree




c++ data-structures linked-list tree






share|improve this question















share|improve this question













share|improve this question




share|improve this question








edited Nov 11 at 2:22









user1118321

19.2k43963




19.2k43963










asked Nov 11 at 2:16









Bishnu bro

1




1








  • 1




    The problem is actually about finding the longest substring that repeats the most, the current topic is confusing.
    – JiaHao Xu
    Nov 11 at 2:25












  • Please clarify where you are stuck - that is: What have you tried already and where does your current solution fail? See stackoverflow.com/help/on-topic #3.
    – hlg
    Nov 11 at 2:31






  • 1




    "It'd be great if I could get some help." -- unfortunately, stackoverflow.com is not a tutorial web site. This is a Q&A site, with concrete, specific questions on programming-related topics.
    – Sam Varshavchik
    Nov 11 at 2:32










  • @Bishnu bro There is an inconsistency in this question: If you want the highest repetition times, a single-character string probably repeats most.
    – JiaHao Xu
    Nov 11 at 2:33






  • 1




    Why isn't c the answer ?
    – Hiroki
    Nov 11 at 5:10














  • 1




    The problem is actually about finding the longest substring that repeats the most, the current topic is confusing.
    – JiaHao Xu
    Nov 11 at 2:25












  • Please clarify where you are stuck - that is: What have you tried already and where does your current solution fail? See stackoverflow.com/help/on-topic #3.
    – hlg
    Nov 11 at 2:31






  • 1




    "It'd be great if I could get some help." -- unfortunately, stackoverflow.com is not a tutorial web site. This is a Q&A site, with concrete, specific questions on programming-related topics.
    – Sam Varshavchik
    Nov 11 at 2:32










  • @Bishnu bro There is an inconsistency in this question: If you want the highest repetition times, a single-character string probably repeats most.
    – JiaHao Xu
    Nov 11 at 2:33






  • 1




    Why isn't c the answer ?
    – Hiroki
    Nov 11 at 5:10








1




1




The problem is actually about finding the longest substring that repeats the most, the current topic is confusing.
– JiaHao Xu
Nov 11 at 2:25






The problem is actually about finding the longest substring that repeats the most, the current topic is confusing.
– JiaHao Xu
Nov 11 at 2:25














Please clarify where you are stuck - that is: What have you tried already and where does your current solution fail? See stackoverflow.com/help/on-topic #3.
– hlg
Nov 11 at 2:31




Please clarify where you are stuck - that is: What have you tried already and where does your current solution fail? See stackoverflow.com/help/on-topic #3.
– hlg
Nov 11 at 2:31




1




1




"It'd be great if I could get some help." -- unfortunately, stackoverflow.com is not a tutorial web site. This is a Q&A site, with concrete, specific questions on programming-related topics.
– Sam Varshavchik
Nov 11 at 2:32




"It'd be great if I could get some help." -- unfortunately, stackoverflow.com is not a tutorial web site. This is a Q&A site, with concrete, specific questions on programming-related topics.
– Sam Varshavchik
Nov 11 at 2:32












@Bishnu bro There is an inconsistency in this question: If you want the highest repetition times, a single-character string probably repeats most.
– JiaHao Xu
Nov 11 at 2:33




@Bishnu bro There is an inconsistency in this question: If you want the highest repetition times, a single-character string probably repeats most.
– JiaHao Xu
Nov 11 at 2:33




1




1




Why isn't c the answer ?
– Hiroki
Nov 11 at 5:10




Why isn't c the answer ?
– Hiroki
Nov 11 at 5:10

















active

oldest

votes











Your Answer






StackExchange.ifUsing("editor", function () {
StackExchange.using("externalEditor", function () {
StackExchange.using("snippets", function () {
StackExchange.snippets.init();
});
});
}, "code-snippets");

StackExchange.ready(function() {
var channelOptions = {
tags: "".split(" "),
id: "1"
};
initTagRenderer("".split(" "), "".split(" "), channelOptions);

StackExchange.using("externalEditor", function() {
// Have to fire editor after snippets, if snippets enabled
if (StackExchange.settings.snippets.snippetsEnabled) {
StackExchange.using("snippets", function() {
createEditor();
});
}
else {
createEditor();
}
});

function createEditor() {
StackExchange.prepareEditor({
heartbeatType: 'answer',
convertImagesToLinks: true,
noModals: true,
showLowRepImageUploadWarning: true,
reputationToPostImages: 10,
bindNavPrevention: true,
postfix: "",
imageUploader: {
brandingHtml: "Powered by u003ca class="icon-imgur-white" href="https://imgur.com/"u003eu003c/au003e",
contentPolicyHtml: "User contributions licensed under u003ca href="https://creativecommons.org/licenses/by-sa/3.0/"u003ecc by-sa 3.0 with attribution requiredu003c/au003e u003ca href="https://stackoverflow.com/legal/content-policy"u003e(content policy)u003c/au003e",
allowUrls: true
},
onDemand: true,
discardSelector: ".discard-answer"
,immediatelyShowMarkdownHelp:true
});


}
});














 

draft saved


draft discarded


















StackExchange.ready(
function () {
StackExchange.openid.initPostLogin('.new-post-login', 'https%3a%2f%2fstackoverflow.com%2fquestions%2f53245277%2ffinding-the-longest-string-with-maximum-repetitions-from-a-file%23new-answer', 'question_page');
}
);

Post as a guest















Required, but never shown






























active

oldest

votes













active

oldest

votes









active

oldest

votes






active

oldest

votes
















 

draft saved


draft discarded



















































 


draft saved


draft discarded














StackExchange.ready(
function () {
StackExchange.openid.initPostLogin('.new-post-login', 'https%3a%2f%2fstackoverflow.com%2fquestions%2f53245277%2ffinding-the-longest-string-with-maximum-repetitions-from-a-file%23new-answer', 'question_page');
}
);

Post as a guest















Required, but never shown





















































Required, but never shown














Required, but never shown












Required, but never shown







Required, but never shown

































Required, but never shown














Required, but never shown












Required, but never shown







Required, but never shown







-

Popular posts from this blog

Bressuire

Image
Subprefecture and commune in Nouvelle-Aquitaine, France Bressuire Subprefecture and commune Chateau de Bressuire and the Eglise Notre-Dame Coat of arms Location of Bressuire Bressuire Show map of France Bressuire Show map of Nouvelle-Aquitaine Coordinates: 46°50′27″N 0°29′14″W  /  46.8408°N 0.4872°W  / 46.8408; -0.4872 Coordinates: 46°50′27″N 0°29′14″W  /  46.8408°N 0.4872°W  / 46.8408; -0.4872 Country France Region Nouvelle-Aquitaine Department Deux-Sèvres Arrondissement Bressuire Canton Bressuire Government  • Mayor .mw-parser-output .nobold{font-weight:normal} (2014–20) Jean Michel Bernier Area 1 180.59 km 2 (69.73 sq mi) Population (2014) 2 19,300  • Density 110/km 2 (280/sq mi) Time zone UTC+01:00 (CET)  • Summer (DST) UTC+02:00 (CEST) INSEE/Postal code 79049 /79300 Elevation 98–236 m (322–774 ft) (avg. 173 m or 568 ft) 1 French Land Register data, which exclude...
Read more

Vorschmack

Image
Vorschmack Ukrainian Jewish-style vorschmack served on rye bread Course Hors d'oeuvre Region or state Eastern Europe Associated national cuisine Ashkenazi Jewish, Finnish, German, Ukrainian, Polish, Russian Main ingredients Ground meat and/or fish Cookbook: Vorschmack   Media: Vorschmack Vorschmack or forshmak (Yiddish: פֿאָרשמאַק ‎, from archaic German Vorschmack , "foretaste" [1] or "appetizer" [2] ) is an originally East European dish made of salty minced fish or meat. Different variants of this dish are especially common in Ashkenazi Jewish and Finnish cuisine. Some varieties are also known in Russian and Polish cuisine. Contents 1 In Jewish cuisine 2 In Russian cuisine 3 In Polish cuisine 4 In Finnish cuisine 5 See also 6 References In Jewish cuisine According to Gil Marks, the German name points to the possible Germanic origin of this dish. [1] William Pokhlyobkin descr...
Read more

Quarantine

Image
For other uses, see Quarantine (disambiguation). Signal flag "Lima" called the "Yellow Jack" which when flown in harbor means ship is under quarantine. A simple yellow flag (also called the "Yellow Jack") had historically been used to signal quarantine (it stands for Q among signal flags), but now indicates the opposite, as a signal of a ship free of disease that requests boarding and inspection. A quarantine is used to separate and restrict the movement of people; it is 'a restraint upon the activities or communication of persons or the transport of goods designed to prevent the spread of disease or pests', for a certain period of time. [1] This is often used in connection to disease and illness, such as those who may possibly have been exposed to a communicable disease. [2] The term is often erroneously used to mean medical isolation, which is "to separate ill persons who have a communicable disease from those who are healthy...
Read more