Vfrdtyky

up vote 0 down vote favorite I'm having trouble disabling CORS for a tabulator ajax request. Have tried to use values from fetch configuration passed in ajaxConfig but to no avail. If I take out ajaxConfig I get hit with CORS but If I send the ajaxConfig stuff I get an error: load Error - Connection Error: TypeError: Failed to execute 'fetch' on 'Window': Request with GET/HEAD method cannot have body. Code below - thanks for any ideas var table = new Tabulator("#example-table", { ajaxURL:"https://amz-apigw/xx", ajaxConfig:{ method:"GET", mode: "no-cors", credentials: "omit", headers: { "Content-type": 'application/json; charset=utf-8' } } }); ...

up vote -3 down vote favorite This is my question. And I am stuck. It'd be great if I could get some help. Write a program to find the biggest string that appears maximum times in the DNA.txt (uploaded on moodle). For example: Consider the following sequence DNA_X : DNA_X: acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt In the above sequence, the string “acccgttac” is the string with the highest length (9) that appears maximum number of times. The highlighted string below has the maximum length with the highest number of occurrence. acccgttacagctgacccgttacgtcaacccgttaccgatacccgttacagt c++ data-structures linked-list tree share | improve this question ...